paper n a thp1 Search Results


paper n a tzm bl  (ATCC)
99
ATCC paper n a tzm bl
Paper N A Tzm Bl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a tzm bl/product/ATCC
Average 99 stars, based on 1 article reviews
paper n a tzm bl - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier
paper n a thp1  (InvivoGen)
96
InvivoGen paper n a thp1
Paper N A Thp1, supplied by InvivoGen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a thp1/product/InvivoGen
Average 96 stars, based on 1 article reviews
paper n a thp1 - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier
paper n a human thp 1 card8 ko v5 gfp card8 zuc  (DSMZ)
97
DSMZ paper n a human thp 1 card8 ko v5 gfp card8 zuc
Figure 1. The N-Terminal Disordered Region of <t>CARD8</t> Is Required for Inflammasome Activation (A) Diagram of human CARD8 (above) and its predicted disorder (below) as determined by the Sequence-Based Prediction of Disordered Residues for Proteins (SPOT-Disorder) program (Hanson et al., 2017). (B, C, E, and F) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B and E) and cell viability was evaluated by lactate dehy- drogenase (LDH) release (C and F). (D) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 48 h, samples were treated with VbP (10 mM) for 6 h before lysates were immunoprecipitated by anti-FLAG and evaluated by immunoblotting. Immunoblot depicts input whole-cell lysate (WCL) and captured proteins (immunopre- cipitation [IP]: FLAG). Residues that were mutated to create start sites are indicated. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. FL, full length; CL, cleaved GSDMD; ZUC, ZU5-UPA-CARD domains of CARD8. Related to Figure S1.
Paper N A Human Thp 1 Card8 Ko V5 Gfp Card8 Zuc, supplied by DSMZ, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a human thp 1 card8 ko v5 gfp card8 zuc/product/DSMZ
Average 97 stars, based on 1 article reviews
paper n a human thp 1 card8 ko v5 gfp card8 zuc - by Bioz Stars, 2026-02
97/100 stars
  Buy from Supplier
trizma base  (Millipore)
90
Millipore trizma base
Figure 1. The N-Terminal Disordered Region of <t>CARD8</t> Is Required for Inflammasome Activation (A) Diagram of human CARD8 (above) and its predicted disorder (below) as determined by the Sequence-Based Prediction of Disordered Residues for Proteins (SPOT-Disorder) program (Hanson et al., 2017). (B, C, E, and F) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B and E) and cell viability was evaluated by lactate dehy- drogenase (LDH) release (C and F). (D) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 48 h, samples were treated with VbP (10 mM) for 6 h before lysates were immunoprecipitated by anti-FLAG and evaluated by immunoblotting. Immunoblot depicts input whole-cell lysate (WCL) and captured proteins (immunopre- cipitation [IP]: FLAG). Residues that were mutated to create start sites are indicated. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. FL, full length; CL, cleaved GSDMD; ZUC, ZU5-UPA-CARD domains of CARD8. Related to Figure S1.
Trizma Base, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trizma base/product/Millipore
Average 90 stars, based on 1 article reviews
trizma base - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
paper n a mv  (ATCC)
99
ATCC paper n a mv
Figure 1. The N-Terminal Disordered Region of <t>CARD8</t> Is Required for Inflammasome Activation (A) Diagram of human CARD8 (above) and its predicted disorder (below) as determined by the Sequence-Based Prediction of Disordered Residues for Proteins (SPOT-Disorder) program (Hanson et al., 2017). (B, C, E, and F) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B and E) and cell viability was evaluated by lactate dehy- drogenase (LDH) release (C and F). (D) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 48 h, samples were treated with VbP (10 mM) for 6 h before lysates were immunoprecipitated by anti-FLAG and evaluated by immunoblotting. Immunoblot depicts input whole-cell lysate (WCL) and captured proteins (immunopre- cipitation [IP]: FLAG). Residues that were mutated to create start sites are indicated. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. FL, full length; CL, cleaved GSDMD; ZUC, ZU5-UPA-CARD domains of CARD8. Related to Figure S1.
Paper N A Mv, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a mv/product/ATCC
Average 99 stars, based on 1 article reviews
paper n a mv - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier
paper n a otud3 knockdown thp1  (Cyagen Biosciences)
91
Cyagen Biosciences paper n a otud3 knockdown thp1
Figure 1. The N-Terminal Disordered Region of <t>CARD8</t> Is Required for Inflammasome Activation (A) Diagram of human CARD8 (above) and its predicted disorder (below) as determined by the Sequence-Based Prediction of Disordered Residues for Proteins (SPOT-Disorder) program (Hanson et al., 2017). (B, C, E, and F) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B and E) and cell viability was evaluated by lactate dehy- drogenase (LDH) release (C and F). (D) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 48 h, samples were treated with VbP (10 mM) for 6 h before lysates were immunoprecipitated by anti-FLAG and evaluated by immunoblotting. Immunoblot depicts input whole-cell lysate (WCL) and captured proteins (immunopre- cipitation [IP]: FLAG). Residues that were mutated to create start sites are indicated. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. FL, full length; CL, cleaved GSDMD; ZUC, ZU5-UPA-CARD domains of CARD8. Related to Figure S1.
Paper N A Otud3 Knockdown Thp1, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a otud3 knockdown thp1/product/Cyagen Biosciences
Average 91 stars, based on 1 article reviews
paper n a otud3 knockdown thp1 - by Bioz Stars, 2026-02
91/100 stars
  Buy from Supplier
paper n a hela msting gfp cells  (InvivoGen)
94
InvivoGen paper n a hela msting gfp cells
Figure 1. The N-Terminal Disordered Region of <t>CARD8</t> Is Required for Inflammasome Activation (A) Diagram of human CARD8 (above) and its predicted disorder (below) as determined by the Sequence-Based Prediction of Disordered Residues for Proteins (SPOT-Disorder) program (Hanson et al., 2017). (B, C, E, and F) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B and E) and cell viability was evaluated by lactate dehy- drogenase (LDH) release (C and F). (D) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 48 h, samples were treated with VbP (10 mM) for 6 h before lysates were immunoprecipitated by anti-FLAG and evaluated by immunoblotting. Immunoblot depicts input whole-cell lysate (WCL) and captured proteins (immunopre- cipitation [IP]: FLAG). Residues that were mutated to create start sites are indicated. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. FL, full length; CL, cleaved GSDMD; ZUC, ZU5-UPA-CARD domains of CARD8. Related to Figure S1.
Paper N A Hela Msting Gfp Cells, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a hela msting gfp cells/product/InvivoGen
Average 94 stars, based on 1 article reviews
paper n a hela msting gfp cells - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

Image Search Results


Figure 1. The N-Terminal Disordered Region of CARD8 Is Required for Inflammasome Activation (A) Diagram of human CARD8 (above) and its predicted disorder (below) as determined by the Sequence-Based Prediction of Disordered Residues for Proteins (SPOT-Disorder) program (Hanson et al., 2017). (B, C, E, and F) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B and E) and cell viability was evaluated by lactate dehy- drogenase (LDH) release (C and F). (D) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 48 h, samples were treated with VbP (10 mM) for 6 h before lysates were immunoprecipitated by anti-FLAG and evaluated by immunoblotting. Immunoblot depicts input whole-cell lysate (WCL) and captured proteins (immunopre- cipitation [IP]: FLAG). Residues that were mutated to create start sites are indicated. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. FL, full length; CL, cleaved GSDMD; ZUC, ZU5-UPA-CARD domains of CARD8. Related to Figure S1.

Journal: Cell reports

Article Title: Activation of the CARD8 Inflammasome Requires a Disordered Region.

doi: 10.1016/j.celrep.2020.108264

Figure Lengend Snippet: Figure 1. The N-Terminal Disordered Region of CARD8 Is Required for Inflammasome Activation (A) Diagram of human CARD8 (above) and its predicted disorder (below) as determined by the Sequence-Based Prediction of Disordered Residues for Proteins (SPOT-Disorder) program (Hanson et al., 2017). (B, C, E, and F) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B and E) and cell viability was evaluated by lactate dehy- drogenase (LDH) release (C and F). (D) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 48 h, samples were treated with VbP (10 mM) for 6 h before lysates were immunoprecipitated by anti-FLAG and evaluated by immunoblotting. Immunoblot depicts input whole-cell lysate (WCL) and captured proteins (immunopre- cipitation [IP]: FLAG). Residues that were mutated to create start sites are indicated. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. FL, full length; CL, cleaved GSDMD; ZUC, ZU5-UPA-CARD domains of CARD8. Related to Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human THP-1 CARD8 KO + CARD8 This paper N/A Human THP-1 CARD8 KO + CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + GFP-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + V5-GFP-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + MTMR1(M1-Q94)-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + D2HGDH(M1-R51)-CARD8 ZUC This paper N/A Human OCI-AML2 DSMZ ACC 99 Human MV-4-11 DSMZ N/A Mouse RAW 264.7 ATCC TIB-71 Oligonucleotides Primer for CARD8 FL: ATGGAAAAAAAGGAGTGTCCAG This paper N/A Primer for CARD8 ZUC: atggggcctgaaggaaatgtggatg This paper N/A Primer for CARD8 G131M-537: ATGGACATTTGCTCAGAAGAG This paper N/A Primer for CARD8 K147M-537: atgGTCTGTTTTGAGATCGAAG This paper N/A Primer for CARD8 F150M-537: ATGGAGATCGAAGAAGATTATAAAAATCG This paper N/A Primer for CARD8 E153M-537: ATGGAAGATTATAAAAATCGTCAGTTTCTG This paper N/A Primer for CARD8 Y156M-537: ATGAAAAATCGTCAGTTTCTGGGG This paper N/A Primer for CARD8 K157M-537: atgAATCGTCAGTTTCTGGG This paper N/A Primer for CARD8 UPA-CARD: atgcgcctctccatccccatcac This paper N/A sgRNA target sequence for CARD8: TGACGATTGCGTTTGGTTCC Johnson et al., 2018 N/A Recombinant DNA pLEX_307 Gift from David Root Addgene Plasmid Cat #41392 MTMR1 Origene RC212024 D2HGDH Genscript OHu27566 pEGFP-GFP11-Clathrin light chain Gift from Bo Huang Addgene Plasmid Cat #70217 pcDNA3.1-GFP(1-10) Gift from Bo Huang Addgene Plasmid Cat #70219 pLEX_307_CARD8 (and truncations) This paper N/A pLEX_307_HA-GSSGnx-CARD8 ZUC This paper N/A pLEX_307_GFP-CARD8 ZUC This paper N/A pLEX_307_V5-GFP-CARD8 ZUC This paper N/A pLEX_307_GFP(1-10)-CARD8 ZUC This paper N/A pLEX_307_MTMR1(M1-Q94)-CARD8 ZUC This paper N/A pLEX_307_MTMR1 This paper N/A pLEX_307_MTMR1D1-94 This paper N/A pLEX_307_D2HGDH This paper N/A pLEX_307_D2HGDHD1-51 This paper N/A Software and Algorithms GraphPad Prism Version 7 GraphPad Software https://www.graphpad.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Proteome Discoverer version 2.2.0.388 Thermo Fisher Scientific OPTON-30945

Techniques: Activation Assay, Sequencing, Stable Transfection, Expressing, Transfection, Construct, Western Blot, Immunoprecipitation

Figure 2. Unrelated Disordered Sequences Create Functional CARD8 Chimeras (A–D, G, and H) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with plasmids encoding full-length CARD8, CARD8ZUC, or variously N-terminally tagged CARD8ZUC (0.02 mg). In (G) and (H), GFP11 was co-transfected at the indicated plasmid ratios. After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B, D, and H) and cell viability was evaluated by LDH release (A, C, and G). Cropped images in (D) are from the same membrane. (E) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 16–20 h, cells were harvested, lysed, and incubated with varying concentrations of trypsin (20, 2, and 0.2 ng/mL) or proteinase K (PROK) (4, 0.8, 0.16, and 0.032 ng/mL) before immunoblotting. (F) HEK293T cells were transiently transfected with the indicated CARD8ZUC-containing constructs (0.02 mg), together with a red fluorescent protein (RFP)- encoding filler plasmid. GFP11 was co-transfected at the indicated plasmid ratios. After 16–20 h, cells were imaged by fluorescence microscopy. A RFP-positive signal was used to show total cell area. Representative images are shown. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. Related to Figures S1 and S2.

Journal: Cell reports

Article Title: Activation of the CARD8 Inflammasome Requires a Disordered Region.

doi: 10.1016/j.celrep.2020.108264

Figure Lengend Snippet: Figure 2. Unrelated Disordered Sequences Create Functional CARD8 Chimeras (A–D, G, and H) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with plasmids encoding full-length CARD8, CARD8ZUC, or variously N-terminally tagged CARD8ZUC (0.02 mg). In (G) and (H), GFP11 was co-transfected at the indicated plasmid ratios. After 16–20 h, samples were treated with VbP (10 mM) for 6 h before lysates were evaluated by immunoblotting (B, D, and H) and cell viability was evaluated by LDH release (A, C, and G). Cropped images in (D) are from the same membrane. (E) HEK293T cells were transiently transfected with the indicated constructs (2 mg). After 16–20 h, cells were harvested, lysed, and incubated with varying concentrations of trypsin (20, 2, and 0.2 ng/mL) or proteinase K (PROK) (4, 0.8, 0.16, and 0.032 ng/mL) before immunoblotting. (F) HEK293T cells were transiently transfected with the indicated CARD8ZUC-containing constructs (0.02 mg), together with a red fluorescent protein (RFP)- encoding filler plasmid. GFP11 was co-transfected at the indicated plasmid ratios. After 16–20 h, cells were imaged by fluorescence microscopy. A RFP-positive signal was used to show total cell area. Representative images are shown. Data are means ± SEM of three biological replicates. ***p < 0.001 and **p < 0.01 by two-sided Student’s t test compared with mock. Data are representative of three or more independent experiments. Related to Figures S1 and S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human THP-1 CARD8 KO + CARD8 This paper N/A Human THP-1 CARD8 KO + CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + GFP-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + V5-GFP-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + MTMR1(M1-Q94)-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + D2HGDH(M1-R51)-CARD8 ZUC This paper N/A Human OCI-AML2 DSMZ ACC 99 Human MV-4-11 DSMZ N/A Mouse RAW 264.7 ATCC TIB-71 Oligonucleotides Primer for CARD8 FL: ATGGAAAAAAAGGAGTGTCCAG This paper N/A Primer for CARD8 ZUC: atggggcctgaaggaaatgtggatg This paper N/A Primer for CARD8 G131M-537: ATGGACATTTGCTCAGAAGAG This paper N/A Primer for CARD8 K147M-537: atgGTCTGTTTTGAGATCGAAG This paper N/A Primer for CARD8 F150M-537: ATGGAGATCGAAGAAGATTATAAAAATCG This paper N/A Primer for CARD8 E153M-537: ATGGAAGATTATAAAAATCGTCAGTTTCTG This paper N/A Primer for CARD8 Y156M-537: ATGAAAAATCGTCAGTTTCTGGGG This paper N/A Primer for CARD8 K157M-537: atgAATCGTCAGTTTCTGGG This paper N/A Primer for CARD8 UPA-CARD: atgcgcctctccatccccatcac This paper N/A sgRNA target sequence for CARD8: TGACGATTGCGTTTGGTTCC Johnson et al., 2018 N/A Recombinant DNA pLEX_307 Gift from David Root Addgene Plasmid Cat #41392 MTMR1 Origene RC212024 D2HGDH Genscript OHu27566 pEGFP-GFP11-Clathrin light chain Gift from Bo Huang Addgene Plasmid Cat #70217 pcDNA3.1-GFP(1-10) Gift from Bo Huang Addgene Plasmid Cat #70219 pLEX_307_CARD8 (and truncations) This paper N/A pLEX_307_HA-GSSGnx-CARD8 ZUC This paper N/A pLEX_307_GFP-CARD8 ZUC This paper N/A pLEX_307_V5-GFP-CARD8 ZUC This paper N/A pLEX_307_GFP(1-10)-CARD8 ZUC This paper N/A pLEX_307_MTMR1(M1-Q94)-CARD8 ZUC This paper N/A pLEX_307_MTMR1 This paper N/A pLEX_307_MTMR1D1-94 This paper N/A pLEX_307_D2HGDH This paper N/A pLEX_307_D2HGDHD1-51 This paper N/A Software and Algorithms GraphPad Prism Version 7 GraphPad Software https://www.graphpad.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Proteome Discoverer version 2.2.0.388 Thermo Fisher Scientific OPTON-30945

Techniques: Functional Assay, Stable Transfection, Expressing, Transfection, Plasmid Preparation, Western Blot, Membrane, Construct, Incubation, Microscopy

Figure 4. Disorder Is the Key Feature of Degraded Proteins (A) Diagrams of human MTMR1 and D2HGDH (above) and corresponding predicted disorder plots (below) (Hanson et al., 2017). (B) HEK293T cells were transiently transfected with plasmids encoding either the full-length or N-terminally truncated, disorder free (DN-term), indicated con- structs (2 mg). After 16–20 h, cells were harvested, lysed, and incubated with varying concentrations of trypsin (20, 2, and 0.2 ng/mL) or PROK (4, 0.8, 0.16, and 0.032 ng/mL) before immunoblotting. (C) HEK293T cells were transiently transfected with plasmids encoding the full-length or N-terminally truncated indicated constructs (0.1 mg). After 16–20 h, cells were treated with VbP (10 mM) for 18 h before protein levels were evaluated by immunoblotting. (D and E) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with plasmids encoding the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before cell viability was evaluated by LDH release (D) and lysates were evaluated by immunoblotting (E). (F and G) THP-1 CARD8/ monocytes stably expressing the indicated constructs were treated with compound 8j (20 mM) or VbP (10 mM). After 24 h, cell viability was evaluated by LDH release (F) and lysates were evaluated by immunoblotting (G). (H) Schematic of the proposed CARD8 activation mechanism, which involves the degradation of its disordered N-terminus. Related to Figure S4.

Journal: Cell reports

Article Title: Activation of the CARD8 Inflammasome Requires a Disordered Region.

doi: 10.1016/j.celrep.2020.108264

Figure Lengend Snippet: Figure 4. Disorder Is the Key Feature of Degraded Proteins (A) Diagrams of human MTMR1 and D2HGDH (above) and corresponding predicted disorder plots (below) (Hanson et al., 2017). (B) HEK293T cells were transiently transfected with plasmids encoding either the full-length or N-terminally truncated, disorder free (DN-term), indicated con- structs (2 mg). After 16–20 h, cells were harvested, lysed, and incubated with varying concentrations of trypsin (20, 2, and 0.2 ng/mL) or PROK (4, 0.8, 0.16, and 0.032 ng/mL) before immunoblotting. (C) HEK293T cells were transiently transfected with plasmids encoding the full-length or N-terminally truncated indicated constructs (0.1 mg). After 16–20 h, cells were treated with VbP (10 mM) for 18 h before protein levels were evaluated by immunoblotting. (D and E) HEK293T cells stably expressing human CASP1 and GSDMD were transiently transfected with plasmids encoding the indicated constructs (0.02 mg). After 16–20 h, samples were treated with VbP (10 mM) for 6 h before cell viability was evaluated by LDH release (D) and lysates were evaluated by immunoblotting (E). (F and G) THP-1 CARD8/ monocytes stably expressing the indicated constructs were treated with compound 8j (20 mM) or VbP (10 mM). After 24 h, cell viability was evaluated by LDH release (F) and lysates were evaluated by immunoblotting (G). (H) Schematic of the proposed CARD8 activation mechanism, which involves the degradation of its disordered N-terminus. Related to Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human THP-1 CARD8 KO + CARD8 This paper N/A Human THP-1 CARD8 KO + CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + GFP-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + V5-GFP-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + MTMR1(M1-Q94)-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + D2HGDH(M1-R51)-CARD8 ZUC This paper N/A Human OCI-AML2 DSMZ ACC 99 Human MV-4-11 DSMZ N/A Mouse RAW 264.7 ATCC TIB-71 Oligonucleotides Primer for CARD8 FL: ATGGAAAAAAAGGAGTGTCCAG This paper N/A Primer for CARD8 ZUC: atggggcctgaaggaaatgtggatg This paper N/A Primer for CARD8 G131M-537: ATGGACATTTGCTCAGAAGAG This paper N/A Primer for CARD8 K147M-537: atgGTCTGTTTTGAGATCGAAG This paper N/A Primer for CARD8 F150M-537: ATGGAGATCGAAGAAGATTATAAAAATCG This paper N/A Primer for CARD8 E153M-537: ATGGAAGATTATAAAAATCGTCAGTTTCTG This paper N/A Primer for CARD8 Y156M-537: ATGAAAAATCGTCAGTTTCTGGGG This paper N/A Primer for CARD8 K157M-537: atgAATCGTCAGTTTCTGGG This paper N/A Primer for CARD8 UPA-CARD: atgcgcctctccatccccatcac This paper N/A sgRNA target sequence for CARD8: TGACGATTGCGTTTGGTTCC Johnson et al., 2018 N/A Recombinant DNA pLEX_307 Gift from David Root Addgene Plasmid Cat #41392 MTMR1 Origene RC212024 D2HGDH Genscript OHu27566 pEGFP-GFP11-Clathrin light chain Gift from Bo Huang Addgene Plasmid Cat #70217 pcDNA3.1-GFP(1-10) Gift from Bo Huang Addgene Plasmid Cat #70219 pLEX_307_CARD8 (and truncations) This paper N/A pLEX_307_HA-GSSGnx-CARD8 ZUC This paper N/A pLEX_307_GFP-CARD8 ZUC This paper N/A pLEX_307_V5-GFP-CARD8 ZUC This paper N/A pLEX_307_GFP(1-10)-CARD8 ZUC This paper N/A pLEX_307_MTMR1(M1-Q94)-CARD8 ZUC This paper N/A pLEX_307_MTMR1 This paper N/A pLEX_307_MTMR1D1-94 This paper N/A pLEX_307_D2HGDH This paper N/A pLEX_307_D2HGDHD1-51 This paper N/A Software and Algorithms GraphPad Prism Version 7 GraphPad Software https://www.graphpad.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Proteome Discoverer version 2.2.0.388 Thermo Fisher Scientific OPTON-30945

Techniques: Transfection, Incubation, Western Blot, Construct, Stable Transfection, Expressing, Activation Assay